Cherry SNP DataBase

SNP information

Name Pav_sc0001124.1_217077Y
Chr PAV_r1.0chr3
Pos (Chr) 183736
PAV_r1.0 Pav_sc0001124.1
Pos (PAV_r1.0) 217077
REF T
ALT C
SSR motif
Gene Name Pav_sc0001124.1_g320.1.mk
Annotation PREDICTED: LOW QUALITY PROTEIN: protein REVEILLE 1
snpEff Effect synonymous_variant
Impact LOW
Codon c.234T>C
Amino Acid p.Leu78Leu
PCR Forward primer TGACTCTGCTCCCAAGGTTT
Reverse primer ATCTCCAGCCAGCTTTCACA
Product size 326
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF ALT/ALT ALT/ALT ALT/ALT ALT/ALT REF/ALT


| Top |