Cherry SNP DataBase

SNP information

Name Pav_sc0001124.1_286235R
Chr PAV_r1.0chr3
Pos (Chr) 114578
PAV_r1.0 Pav_sc0001124.1
Pos (PAV_r1.0) 286235
REF A
ALT G
SSR motif
Gene Name Pav_sc0001124.1_g400.1.mk
Annotation PREDICTED: probable polyamine oxidase 4
snpEff Effect synonymous_variant
Impact LOW
Codon c.600A>G
Amino Acid p.Ala200Ala
PCR Forward primer GTGATGGATAGGCATCCAGA
Reverse primer TCAATTGTAAGGAGGCCAGC
Product size 265
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF ALT/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |