Cherry SNP DataBase

SNP information

Name Pav_sc0001124.1_375127R
Chr PAV_r1.0chr3
Pos (Chr) 25686
PAV_r1.0 Pav_sc0001124.1
Pos (PAV_r1.0) 375127
REF A
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.375127A>G
Amino Acid
PCR Forward primer ACGACGGAGAGAGCTGAGAG
Reverse primer CCATCATTGATATCCCCAGAA
Product size 322
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT


| Top |