Cherry SNP DataBase

SNP information

Name Pav_sc0001129.1_33409Y
Chr PAV_r1.0chr2
Pos (Chr) 3280201
PAV_r1.0 Pav_sc0001129.1
Pos (PAV_r1.0) 33409
REF T
ALT C
SSR motif
Gene Name Pav_sc0001129.1_g050.1.mk
Annotation PREDICTED: ATP-dependent Clp protease proteolytic subunit 3, chloroplastic
snpEff Effect intron_variant
Impact MODIFIER
Codon c.702+41T>C
Amino Acid
PCR Forward primer ATTCAGGCAACAGAAATGGG
Reverse primer CCTGGCTTTCCATCATCAAT
Product size 286
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |