Cherry SNP DataBase

SNP information

Name Pav_sc0001183.1_147888S
Chr PAV_r1.0chr2
Pos (Chr) 18160307
PAV_r1.0 Pav_sc0001183.1
Pos (PAV_r1.0) 147888
REF G
ALT C
SSR motif
Gene Name Pav_sc0001183.1_g330.1.mk
Annotation PREDICTED: pullulanase 1, chloroplastic
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1849-105C>G
Amino Acid
PCR Forward primer GGTGTCCCACCATATGTCAA
Reverse primer CCATTAATCTCGCATCAGCA
Product size 213
Enzymes for CAPS AluI
Exp. fragment size (REF) 83,84,46
Exp. fragment size (ALT) 83,59,25,46
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/ALT REF/ALT REF/REF REF/ALT


| Top |