Cherry SNP DataBase

SNP information

Name Pav_sc0001203.1_85976W
Chr PAV_r1.0chr2
Pos (Chr) 33631
PAV_r1.0 Pav_sc0001203.1
Pos (PAV_r1.0) 85976
REF A
ALT T
SSR motif
Gene Name Pav_sc0001203.1_g140.1.mk
Annotation PREDICTED: cycloartenol-C-24-methyltransferase
snpEff Effect intron_variant
Impact MODIFIER
Codon c.570+81A>T
Amino Acid
PCR Forward primer TTGCCCCACAGGAACTAAAC
Reverse primer CATGAAGTCAGCCTGCAAAA
Product size 217
Enzymes for CAPS AluI
Exp. fragment size (REF) 217
Exp. fragment size (ALT) 138,79
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |