Cherry SNP DataBase

SNP information

Name Pav_sc0001203.1_86044Y
Chr PAV_r1.0chr2
Pos (Chr) 33563
PAV_r1.0 Pav_sc0001203.1
Pos (PAV_r1.0) 86044
REF T
ALT C
SSR motif
Gene Name Pav_sc0001203.1_g140.1.mk
Annotation PREDICTED: cycloartenol-C-24-methyltransferase
snpEff Effect intron_variant
Impact MODIFIER
Codon c.570+149T>C
Amino Acid
PCR Forward primer TTGCAATTTTGTAAAGGTCGG
Reverse primer AGCCAACAGAAACAGGGAGA
Product size 310
Enzymes for CAPS HaeIII
Exp. fragment size (REF) 310
Exp. fragment size (ALT) 163,147
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |