Cherry SNP DataBase

SNP information

Name Pav_sc0001205.1_70479M
Chr PAV_r1.0chr2
Pos (Chr) 21460333
PAV_r1.0 Pav_sc0001205.1
Pos (PAV_r1.0) 70479
REF C
ALT A
SSR motif
Gene Name Pav_sc0001205.1_g160.1.mk
Annotation PREDICTED: alpha-soluble NSF attachment protein 2-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.349-164G>T
Amino Acid
PCR Forward primer GCATCAAGGCCCATACAAGT
Reverse primer TGCAGTTCCCTTTTCCATTC
Product size 256
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |