Cherry SNP DataBase

SNP information

Name Pav_sc0001215.1_115540M
Chr PAV_r1.0chr3
Pos (Chr) 13489939
PAV_r1.0 Pav_sc0001215.1
Pos (PAV_r1.0) 115540
REF C
ALT A
SSR motif
Gene Name Pav_sc0001215.1_g220.1.mk
Annotation hypothetical protein JCGZ_18643
snpEff Effect missense_variant
Impact MODERATE
Codon c.147C>A
Amino Acid p.Asp49Glu
PCR Forward primer GCTGTCACAAGACCAAGCAA
Reverse primer GCTTTCAGATACCCAAAGCG
Product size 236
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF ALT/ALT REF/REF REF/ALT REF/ALT REF/ALT


| Top |