Cherry SNP DataBase

SNP information

Name Pav_sc0001240.1_46522R
Chr PAV_r1.0chr3
Pos (Chr) 22460403
PAV_r1.0 Pav_sc0001240.1
Pos (PAV_r1.0) 46522
REF A
ALT G
SSR motif
Gene Name Pav_sc0001240.1_g070.1.mk
Annotation PREDICTED: lysine histidine transporter 1-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.192-201A>G
Amino Acid
PCR Forward primer GTGTATCTTTGGCAGCAGCA
Reverse primer TGCCCAAGCAATGGTAGAGT
Product size 336
Enzymes for CAPS MboI
Exp. fragment size (REF) 112,224
Exp. fragment size (ALT) 336
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT ALT/ALT REF/REF REF/REF REF/ALT


| Top |