Cherry SNP DataBase

SNP information

Name Pav_sc0001258.1_188472Y
Chr PAV_r1.0chr1
Pos (Chr) 34126771
PAV_r1.0 Pav_sc0001258.1
Pos (PAV_r1.0) 188472
REF T
ALT C
SSR motif
Gene Name Pav_sc0001258.1_g360.1.mk
Annotation PREDICTED: probable ADP-ribosylation factor GTPase-activating protein AGD14
snpEff Effect missense_variant
Impact MODERATE
Codon c.1150T>C
Amino Acid p.Cys384Arg
PCR Forward primer TTCCAAATCCAGACCCTTTG
Reverse primer GATTGCTGCATACATGGTGG
Product size 337
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |