Cherry SNP DataBase

SNP information

Name Pav_sc0001275.1_185020Y
Chr PAV_r1.0chr1
Pos (Chr) 35305993
PAV_r1.0 Pav_sc0001275.1
Pos (PAV_r1.0) 185020
REF C
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.185020C>T
Amino Acid
PCR Forward primer TGAATGCATGCAGTGACAGA
Reverse primer AAGGAAACAAAAGCAATGCG
Product size 203
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/REF REF/REF ALT/ALT ALT/ALT REF/ALT


| Top |