Cherry SNP DataBase

SNP information

Name Pav_sc0001289.1_100161W
Chr PAV_r1.0chr4
Pos (Chr) 4463107
PAV_r1.0 Pav_sc0001289.1
Pos (PAV_r1.0) 100161
REF A
ALT T
SSR motif
Gene Name Pav_sc0001289.1_g140.1.mk
Annotation PREDICTED: bidirectional sugar transporter SWEET2a-like
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*336A>T
Amino Acid
PCR Forward primer TCGTTGTTGGCCATAAAGTG
Reverse primer ATGCTCTTGCTCCAAAATGG
Product size 261
Enzymes for CAPS AfaI | KpnI
Exp. fragment size (REF) 158,103 | 160,101
Exp. fragment size (ALT) 261 | 261
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |