Cherry SNP DataBase

SNP information

Name Pav_sc0001289.1_280467W
Chr PAV_r1.0chr4
Pos (Chr) 4643413
PAV_r1.0 Pav_sc0001289.1
Pos (PAV_r1.0) 280467
REF T
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.280467T>A
Amino Acid
PCR Forward primer TTGACTGGGGAACCAAAGAC
Reverse primer ATGCCCCTCCATTTTACCAG
Product size 260
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |