Cherry SNP DataBase

SNP information

Name Pav_sc0001289.1_37437Y
Chr PAV_r1.0chr4
Pos (Chr) 4400383
PAV_r1.0 Pav_sc0001289.1
Pos (PAV_r1.0) 37437
REF T
ALT C
SSR motif
Gene Name Pav_sc0001289.1_g030.1.mk
Annotation PREDICTED: GDSL esterase/lipase At1g29670-like
snpEff Effect missense_variant
Impact MODERATE
Codon c.1186A>G
Amino Acid p.Thr396Ala
PCR Forward primer AAGCAATGCGTGAGACTGTG
Reverse primer CATCCCATCATTTGCAGCTA
Product size 246
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/ALT ALT/ALT ALT/ALT REF/ALT REF/ALT


| Top |