Cherry SNP DataBase

SNP information

Name Pav_sc0001289.1_98653K
Chr PAV_r1.0chr4
Pos (Chr) 4461599
PAV_r1.0 Pav_sc0001289.1
Pos (PAV_r1.0) 98653
REF T
ALT G
SSR motif
Gene Name Pav_sc0001289.1_g140.1.mk
Annotation PREDICTED: bidirectional sugar transporter SWEET2a-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.62-99T>G
Amino Acid
PCR Forward primer TGTTTCAGGAAGCAAAACCA
Reverse primer ACACAAACAACACGAAGGCA
Product size 304
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |