Cherry SNP DataBase

SNP information

Name Pav_sc0001323.1_584395K
Chr PAV_r1.0chr1
Pos (Chr) 40680625
PAV_r1.0 Pav_sc0001323.1
Pos (PAV_r1.0) 584395
REF T
ALT G
SSR motif
Gene Name Pav_sc0001323.1_g980.1.mk
Annotation PREDICTED: tubulin gamma-1 chain
snpEff Effect intron_variant
Impact MODIFIER
Codon c.130-61T>G
Amino Acid
PCR Forward primer TGTGGCTGTAAGGGTCATCA
Reverse primer AGCTCGCGGTATGTAGTGCT
Product size 204
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |