Cherry SNP DataBase

SNP information

Name Pav_sc0001335.1_130883W
Chr PAV_r1.0chr2
Pos (Chr) 24189041
PAV_r1.0 Pav_sc0001335.1
Pos (PAV_r1.0) 130883
REF T
ALT A
SSR motif
Gene Name Pav_sc0001335.1_g260.1.mk
Annotation PREDICTED: dipeptidyl peptidase 8
snpEff Effect intron_variant
Impact MODIFIER
Codon c.504-781A>T
Amino Acid
PCR Forward primer CAGCTCAGCCATCAAAACAA
Reverse primer TCGTCCCTCGTTATGTTTCC
Product size 327
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/REF REF/REF REF/REF REF/ALT


| Top |