Cherry SNP DataBase

SNP information

Name Pav_sc0001335.1_265338W
Chr PAV_r1.0chr2
Pos (Chr) 24054586
PAV_r1.0 Pav_sc0001335.1
Pos (PAV_r1.0) 265338
REF T
ALT A
SSR motif
Gene Name Pav_sc0001335.1_g490.1.mk
Annotation PREDICTED: probable trehalose-phosphate phosphatase C
snpEff Effect intron_variant
Impact MODIFIER
Codon c.427-40T>A
Amino Acid
PCR Forward primer CAGTGATCAGCGGAAGGAGT
Reverse primer CCATGGCAGTGGTGTAGTTG
Product size 256
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |