Cherry SNP DataBase

SNP information

Name Pav_sc0001335.1_26767W
Chr PAV_r1.0chr2
Pos (Chr) 24293157
PAV_r1.0 Pav_sc0001335.1
Pos (PAV_r1.0) 26767
REF A
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.26767A>T
Amino Acid
PCR Forward primer TGGTGTGGGGTTGATATTGA
Reverse primer TTGCCTGAGTTAGGTTTGGG
Product size 318
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |