Cherry SNP DataBase

SNP information

Name Pav_sc0001335.1_33551W
Chr PAV_r1.0chr2
Pos (Chr) 24286373
PAV_r1.0 Pav_sc0001335.1
Pos (PAV_r1.0) 33551
REF A
ALT T
SSR motif
Gene Name Pav_sc0001335.1_g110.1.mk
Annotation PREDICTED: LOW QUALITY PROTEIN: glutamate synthase
snpEff Effect intron_variant
Impact MODIFIER
Codon c.2412+19T>A
Amino Acid
PCR Forward primer GCCCCTTCACAACTCCACTA
Reverse primer TACTGCTGGTGTGGGTCTCA
Product size 283
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |