Cherry SNP DataBase

SNP information

Name Pav_sc0001335.1_63023W
Chr PAV_r1.0chr2
Pos (Chr) 24256901
PAV_r1.0 Pav_sc0001335.1
Pos (PAV_r1.0) 63023
REF A
ALT T
SSR motif
Gene Name Pav_sc0001335.1_g150.1.mk
Annotation PREDICTED: probable plastid-lipid-associated protein 14, chloroplastic
snpEff Effect intron_variant
Impact MODIFIER
Codon c.911+32T>A
Amino Acid
PCR Forward primer AGCACCATTTTTGCCATCAT
Reverse primer ACTTGGATTTATGCCAACCG
Product size 320
Enzymes for CAPS DraI
Exp. fragment size (REF) 98,222
Exp. fragment size (ALT) 99,221
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT REF/ALT


| Top |