Cherry SNP DataBase

SNP information

Name Pav_sc0001335.1_63636R
Chr PAV_r1.0chr2
Pos (Chr) 24256288
PAV_r1.0 Pav_sc0001335.1
Pos (PAV_r1.0) 63636
REF G
ALT A
SSR motif
Gene Name Pav_sc0001335.1_g150.1.mk
Annotation PREDICTED: probable plastid-lipid-associated protein 14, chloroplastic
snpEff Effect synonymous_variant
Impact LOW
Codon c.615C>T
Amino Acid p.Asp205Asp
PCR Forward primer TCTAATCATTCGCAGTTGCC
Reverse primer CGCTGTTCCTGCATTTATCA
Product size 229
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |