Cherry SNP DataBase

SNP information

Name Pav_sc0001335.1_84265M
Chr PAV_r1.0chr2
Pos (Chr) 24235659
PAV_r1.0 Pav_sc0001335.1
Pos (PAV_r1.0) 84265
REF A
ALT C
SSR motif
Gene Name Pav_sc0001335.1_g190.1.mk
Annotation PREDICTED: histone-lysine N-methyltransferase ATX5
snpEff Effect splice_region_variant&intron_variant
Impact LOW
Codon c.1849-7T>G
Amino Acid
PCR Forward primer GAAGGCCGTTTAGGAGGTTT
Reverse primer AGAGTCGTGTGCAAGTGTGG
Product size 318
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |