Cherry SNP DataBase

SNP information

Name Pav_sc0001339.1_65736S
Chr PAV_r1.0chr6
Pos (Chr) 17122354
PAV_r1.0 Pav_sc0001339.1
Pos (PAV_r1.0) 65736
REF C
ALT G
SSR motif
Gene Name Pav_sc0001339.1_g140.1.mk
Annotation PREDICTED: ecotropic viral integration site 5 protein homolog
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1669-15G>C
Amino Acid
PCR Forward primer AGCAGCTACTTCTTGCTCGG
Reverse primer CTGGGATTTTAGGATTGCGA
Product size 348
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |