Cherry SNP DataBase

SNP information

Name Pav_sc0001340.1_66327W
Chr PAV_r1.0chr4
Pos (Chr) 18175477
PAV_r1.0 Pav_sc0001340.1
Pos (PAV_r1.0) 66327
REF A
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.66327A>T
Amino Acid
PCR Forward primer GATTTATGTGGGCAAGAGGC
Reverse primer GAAAAGATGGAGAAAGCCCC
Product size 294
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |