Cherry SNP DataBase

SNP information

Name Pav_sc0001342.1_137009M
Chr PAV_r1.0chr4
Pos (Chr) 7240937
PAV_r1.0 Pav_sc0001342.1
Pos (PAV_r1.0) 137009
REF A
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.137009A>C
Amino Acid
PCR Forward primer CCAGTGGCTGCTACTCACAA
Reverse primer CTGTGAGGGGCACTTAAAGC
Product size 349
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/ALT ALT/ALT REF/ALT REF/ALT REF/ALT


| Top |