Cherry SNP DataBase

SNP information

Name Pav_sc0001342.1_140112M
Chr PAV_r1.0chr4
Pos (Chr) 7237834
PAV_r1.0 Pav_sc0001342.1
Pos (PAV_r1.0) 140112
REF A
ALT C
SSR motif
Gene Name Pav_sc0001342.1_g170.1.mk
Annotation PREDICTED: APO protein 1, chloroplastic
snpEff Effect intron_variant
Impact MODIFIER
Codon c.129+236A>C
Amino Acid
PCR Forward primer CAGTTGCTGTCGCCTTTTTA
Reverse primer CATCTACCACGACCCCAAGT
Product size 348
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/REF REF/REF


| Top |