Cherry SNP DataBase

SNP information

Name Pav_sc0001355.1_16829Y
Chr PAV_r1.0chr4
Pos (Chr) 20477128
PAV_r1.0 Pav_sc0001355.1
Pos (PAV_r1.0) 16829
REF C
ALT T
SSR motif
Gene Name Pav_sc0001355.1_g030.1.mk
Annotation PREDICTED: receptor-like serine/threonine-protein kinase SD1-8
snpEff Effect synonymous_variant
Impact LOW
Codon c.501C>T
Amino Acid p.Asp167Asp
PCR Forward primer GAAGCAACGTGGGACAGATT
Reverse primer TTTTGCTTCACCTGCAACAG
Product size 350
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/ALT


| Top |