Cherry SNP DataBase

SNP information

Name Pav_sc0001371.1_33067R
Chr PAV_r1.0chr3
Pos (Chr) 7891225
PAV_r1.0 Pav_sc0001371.1
Pos (PAV_r1.0) 33067
REF G
ALT A
SSR motif
Gene Name Pav_sc0001371.1_g080.1.mk
Annotation PREDICTED: putative glucose-6-phosphate 1-epimerase
snpEff Effect intron_variant
Impact MODIFIER
Codon c.299-72C>T
Amino Acid
PCR Forward primer CTGCAATGGAAAAGGACCAT
Reverse primer GAAGGACGGACTTCCAGATG
Product size 348
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |