Cherry SNP DataBase

SNP information

Name Pav_sc0001379.1_20384M
Chr PAV_r1.0chr6
Pos (Chr) 13661167
PAV_r1.0 Pav_sc0001379.1
Pos (PAV_r1.0) 20384
REF C
ALT A
SSR motif
Gene Name Pav_sc0001379.1_g050.1.mk
Annotation PREDICTED: SNW/SKI-interacting protein-like
snpEff Effect missense_variant
Impact MODERATE
Codon c.419G>T
Amino Acid p.Gly140Val
PCR Forward primer CAGCGCTCAATCTCACATTC
Reverse primer CTGTGGATGCACATGGAAAC
Product size 228
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/REF REF/ALT REF/REF REF/ALT


| Top |