Cherry SNP DataBase

SNP information

Name Pav_sc0001405.1_1015940W
Chr PAV_r1.0chr2
Pos (Chr) 23909277
PAV_r1.0 Pav_sc0001405.1
Pos (PAV_r1.0) 1015940
REF A
ALT T
SSR motif
Gene Name Pav_sc0001405.1_g2010.1.mk
Annotation PREDICTED: uncharacterized protein LOC103333776
snpEff Effect missense_variant
Impact MODERATE
Codon c.1209T>A
Amino Acid p.Asn403Lys
PCR Forward primer CTAATGCTCCCTGACCATCC
Reverse primer TGGCAGTGGTGTGACAAAAT
Product size 269
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |