Cherry SNP DataBase

SNP information

Name Pav_sc0001405.1_281237R
Chr PAV_r1.0chr2
Pos (Chr) 23174574
PAV_r1.0 Pav_sc0001405.1
Pos (PAV_r1.0) 281237
REF A
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.281237A>G
Amino Acid
PCR Forward primer TTAAGGGGCACATTCAAAGG
Reverse primer GGTTCAAACTCCATAGGCCA
Product size 247
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |