Cherry SNP DataBase

SNP information

Name Pav_sc0001405.1_338570R
Chr PAV_r1.0chr2
Pos (Chr) 23231907
PAV_r1.0 Pav_sc0001405.1
Pos (PAV_r1.0) 338570
REF A
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.338570A>G
Amino Acid
PCR Forward primer GAGAGGCAGAGCACAAGAGC
Reverse primer GCAGCCTGTGGATGAAGC
Product size 348
Enzymes for CAPS HaeIII
Exp. fragment size (REF) 348
Exp. fragment size (ALT) 235,113
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |