Cherry SNP DataBase

SNP information

Name Pav_sc0001405.1_343813Y
Chr PAV_r1.0chr2
Pos (Chr) 23237150
PAV_r1.0 Pav_sc0001405.1
Pos (PAV_r1.0) 343813
REF C
ALT T
SSR motif
Gene Name Pav_sc0001405.1_g690.1.mk
Annotation PREDICTED: protein FAR1-RELATED SEQUENCE 5-like
snpEff Effect synonymous_variant
Impact LOW
Codon c.2529C>T
Amino Acid p.His843His
PCR Forward primer AAGCGAATCAGGTGGATCAG
Reverse primer ACGACCTCTTGGTATGTGCC
Product size 251
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/ALT ALT/ALT REF/REF


| Top |