Cherry SNP DataBase

SNP information

Name Pav_sc0001405.1_38090M
Chr PAV_r1.0chr2
Pos (Chr) 22931427
PAV_r1.0 Pav_sc0001405.1
Pos (PAV_r1.0) 38090
REF C
ALT A
SSR motif
Gene Name Pav_sc0001405.1_g050.1.mk
Annotation hypothetical protein PRUPE_ppa005730mg
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1092-558C>A
Amino Acid
PCR Forward primer CCGTTGGGATTTGTCTTGTT
Reverse primer CCAAACAAGGTTCCTAATGGTC
Product size 220
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT ALT/ALT ALT/ALT ALT/ALT REF/ALT


| Top |