Cherry SNP DataBase

SNP information

Name Pav_sc0001405.1_630910S
Chr PAV_r1.0chr2
Pos (Chr) 23524247
PAV_r1.0 Pav_sc0001405.1
Pos (PAV_r1.0) 630910
REF G
ALT C
SSR motif
Gene Name Pav_sc0001405.1_g1250.1.mk
Annotation PREDICTED: short-chain dehydrogenase TIC 32, chloroplastic-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.651+174G>C
Amino Acid
PCR Forward primer CAACAAATGAATGGTGCCAG
Reverse primer ATGGGCAGATGTATGCAAGC
Product size 284
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |