Cherry SNP DataBase

SNP information

Name Pav_sc0001405.1_74661R
Chr PAV_r1.0chr2
Pos (Chr) 22967998
PAV_r1.0 Pav_sc0001405.1
Pos (PAV_r1.0) 74661
REF G
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.74661G>A
Amino Acid
PCR Forward primer GAACACGAGCAGAACAACCA
Reverse primer GGACTTGAGCAGCCAGAAAG
Product size 239
Enzymes for CAPS AluI
Exp. fragment size (REF) 72,167
Exp. fragment size (ALT) 239
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |