Cherry SNP DataBase

SNP information

Name Pav_sc0001405.1_846120M
Chr PAV_r1.0chr2
Pos (Chr) 23739457
PAV_r1.0 Pav_sc0001405.1
Pos (PAV_r1.0) 846120
REF A
ALT C
SSR motif
Gene Name Pav_sc0001405.1_g1670.1.mk
Annotation PREDICTED: translocation protein SEC63 homolog
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1113+74T>G
Amino Acid
PCR Forward primer GGGCAATGCCTTCACTGTAT
Reverse primer GGTGACCGTCCATTATCCAC
Product size 256
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |