Cherry SNP DataBase

SNP information

Name Pav_sc0001405.1_958404Y
Chr PAV_r1.0chr2
Pos (Chr) 23851741
PAV_r1.0 Pav_sc0001405.1
Pos (PAV_r1.0) 958404
REF C
ALT T
SSR motif
Gene Name Pav_sc0001405.1_g1890.1.mk
Annotation PREDICTED: S-type anion channel SLAH3-like
snpEff Effect missense_variant
Impact MODERATE
Codon c.170C>T
Amino Acid p.Ser57Phe
PCR Forward primer TTACACCAGGGAATTGAGGC
Reverse primer AGTGCAGAGCTTTTTGGCAT
Product size 248
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |