Cherry SNP DataBase

SNP information

Name Pav_sc0001405.1_961548K
Chr PAV_r1.0chr2
Pos (Chr) 23854885
PAV_r1.0 Pav_sc0001405.1
Pos (PAV_r1.0) 961548
REF T
ALT G
SSR motif
Gene Name Pav_sc0001405.1_g1890.1.mk
Annotation PREDICTED: S-type anion channel SLAH3-like
snpEff Effect synonymous_variant
Impact LOW
Codon c.1689T>G
Amino Acid p.Leu563Leu
PCR Forward primer TTGACTTTGGCAGCTTCTGA
Reverse primer AAGCGCACTTGGTTGATACC
Product size 202
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |