Cherry SNP DataBase

SNP information

Name Pav_sc0001406.1_19133W
Chr PAV_r1.0chr3
Pos (Chr) 2736818
PAV_r1.0 Pav_sc0001406.1
Pos (PAV_r1.0) 19133
REF A
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.19133A>T
Amino Acid
PCR Forward primer CACAGACACTTGCATGTCCA
Reverse primer ATCGCTTTCCTTCCTGGATT
Product size 254
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT REF/REF REF/REF REF/REF -/- REF/ALT


| Top |