Cherry SNP DataBase

SNP information

Name Pav_sc0001411.1_248294M
Chr PAV_r1.0chr3
Pos (Chr) 10874392
PAV_r1.0 Pav_sc0001411.1
Pos (PAV_r1.0) 248294
REF A
ALT C
SSR motif
Gene Name Pav_sc0001411.1_g450.1.mk
Annotation PREDICTED: LOW QUALITY PROTEIN: two pore calcium channel protein 1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1686-365T>G
Amino Acid
PCR Forward primer AAGCCATGTACAAAAACGGG
Reverse primer TGTCTGCAGATTTTAGGGGG
Product size 208
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |