Cherry SNP DataBase

SNP information

Name Pav_sc0001422.1_29105M
Chr PAV_r1.0chr8
Pos (Chr) 12175497
PAV_r1.0 Pav_sc0001422.1
Pos (PAV_r1.0) 29105
REF A
ALT C
SSR motif
Gene Name Pav_sc0001422.1_g050.1.mk
Annotation PREDICTED: uncharacterized protein At4g04775-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.175-39A>C
Amino Acid
PCR Forward primer CCCCTGAAGATTCTGAGCTG
Reverse primer CTCATCGGTCTCCCTATTGC
Product size 269
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT ALT/ALT ALT/ALT ALT/ALT REF/ALT


| Top |