Cherry SNP DataBase

SNP information

Name Pav_sc0001431.1_21082Y
Chr PAV_r1.0chr4
Pos (Chr) 8304143
PAV_r1.0 Pav_sc0001431.1
Pos (PAV_r1.0) 21082
REF T
ALT C
SSR motif
Gene Name Pav_sc0001431.1_g010.1.mk
Annotation PREDICTED: uncharacterized protein LOC103328705
snpEff Effect 5_prime_UTR_variant
Impact MODIFIER
Codon c.-352A>G
Amino Acid
PCR Forward primer TATGAACCTGCCTGCACAAG
Reverse primer CCTCAAACATTGTCCCCATT
Product size 335
Enzymes for CAPS MspI
Exp. fragment size (REF) 335
Exp. fragment size (ALT) 161,174
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT REF/ALT REF/REF REF/REF REF/ALT REF/ALT


| Top |