Cherry SNP DataBase

SNP information

Name Pav_sc0001448.1_73474K
Chr PAV_r1.0chr6
Pos (Chr) 16320965
PAV_r1.0 Pav_sc0001448.1
Pos (PAV_r1.0) 73474
REF G
ALT T
SSR motif
Gene Name Pav_sc0001448.1_g120.1.mk
Annotation PREDICTED: UDP-glycosyltransferase 86A1-like
snpEff Effect 5_prime_UTR_variant
Impact MODIFIER
Codon c.-562C>A
Amino Acid
PCR Forward primer CAAGATGGACAGCTGGGATT
Reverse primer TTCAAGCACATCACCTCACC
Product size 319
Enzymes for CAPS AluI | EcoRV
Exp. fragment size (REF) 12,136,6,84,31,5,21,24 | 319
Exp. fragment size (ALT) 12,142,84,31,5,21,24 | 146,173
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |