Cherry SNP DataBase

SNP information

Name Pav_sc0001488.1_231018W
Chr PAV_r1.0chr3
Pos (Chr) 9205319
PAV_r1.0 Pav_sc0001488.1
Pos (PAV_r1.0) 231018
REF T
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.231018T>A
Amino Acid
PCR Forward primer TCCAAAAGTAACGGGTGCAT
Reverse primer TGTGTTCTTGTGCGTTTTCC
Product size 252
Enzymes for CAPS AluI
Exp. fragment size (REF) 75,177
Exp. fragment size (ALT) 252
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |