Cherry SNP DataBase

SNP information

Name Pav_sc0001513.1_38616R
Chr PAV_r1.0chr7
Pos (Chr) 4564526
PAV_r1.0 Pav_sc0001513.1
Pos (PAV_r1.0) 38616
REF A
ALT G
SSR motif
Gene Name Pav_sc0001513.1_g070.1.mk
Annotation PREDICTED: DNA-directed RNA polymerase V subunit 5A
snpEff Effect intron_variant
Impact MODIFIER
Codon c.562-83T>C
Amino Acid
PCR Forward primer TGCAATCGCATCTTTTCTTG
Reverse primer TTCACTTTCTCCCCTCCAGA
Product size 218
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |