Cherry SNP DataBase

SNP information

Name Pav_sc0001529.1_67537K
Chr PAV_r1.0chr4
Pos (Chr) 217051
PAV_r1.0 Pav_sc0001529.1
Pos (PAV_r1.0) 67537
REF G
ALT T
SSR motif
Gene Name Pav_sc0001529.1_g140.1.mk
Annotation PREDICTED: sister chromatid cohesion protein PDS5 homolog A
snpEff Effect intron_variant
Impact MODIFIER
Codon c.3651-90G>T
Amino Acid
PCR Forward primer GCAAATTCAAGGAAGGTGGA
Reverse primer TGCAGCTTACCACATGCTTC
Product size 344
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT ALT/ALT REF/ALT


| Top |