Cherry SNP DataBase

SNP information

Name Pav_sc0001553.1_17066R
Chr PAV_r1.0chr6
Pos (Chr) 13465542
PAV_r1.0 Pav_sc0001553.1
Pos (PAV_r1.0) 17066
REF A
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.17066A>G
Amino Acid
PCR Forward primer CCCTATGGGCTGAGATGAAA
Reverse primer GATGAGAGGGGGATATGCAA
Product size 309
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/REF REF/ALT REF/REF REF/ALT


| Top |